View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17616_low_26 (Length: 218)

Name: NF17616_low_26
Description: NF17616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17616_low_26
NF17616_low_26
[»] chr6 (1 HSPs)
chr6 (1-184)||(30726327-30726510)


Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 30726327 - 30726510
Alignment:
Q  1 tgaaactatggtagataagttttaaagacaatttagaaaattgataagttcgacctacaaaattttctcaatgnnnnnnnagaggagttttttcaatgtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       || |||||||||||||||||    
T  30726327 tgaaactatggtagataagttttaaagacaatttagaaaattgataagttcgacctacaaaattttctcaatgtttttttagtggagttttttcaatgtt 30726426  T
Q  101 aaatgcaataaccaatttacaaaattgataaatggataataaaaaattgagttgaggagctaattcggaaaacaataaaagcag 184  Q
    |||||||||||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||    
T  30726427 aaatgcaataaccaatttacaaaattgataaatacaaaataaaaaattgagttgaggagctaattcggaaaacaataaaagcag 30726510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University