View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17615_low_39 (Length: 314)

Name: NF17615_low_39
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17615_low_39
NF17615_low_39
[»] chr6 (2 HSPs)
chr6 (3-174)||(21141594-21141766)
chr6 (204-286)||(21141449-21141532)


Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 174
Target Start/End: Complemental strand, 21141766 - 21141594
Alignment:
Q  3 ataaaatagtatggttg-atacgttttagatagtttttattttgaatcaatttttgaattatctaatttgactaaacaatgtttcacctaattaacttgt 101  Q
    |||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||| ||||    
T  21141766 ataaaataatatggttggatacgtttgagatagtttttattttgaatcaatttttgaattatctaaattgactaaacaaagtttaacctaattaatttgt 21141667  T
Q  102 ttgtgaatttgaaatggaccgagtttgagctaaaaaacatgtttgtatcgaactcaaatcgagttttaaacaa 174  Q
    |||||||||||||||| ||  |||| |||||||||||||||||| |||||||||||||| |||||||||||||    
T  21141666 ttgtgaatttgaaatgaacaaagttcgagctaaaaaacatgtttttatcgaactcaaattgagttttaaacaa 21141594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 204 - 286
Target Start/End: Complemental strand, 21141532 - 21141449
Alignment:
Q  204 aacatcctagatggtcaaattggggggattgcatttaatttc-aaaatcattggattgcatcattagatagaatgggaagatct 286  Q
    ||||||||||||| |||||||||||  ||||||||||||||| ||||||||| ||||||||  || ||||||||||||||||||    
T  21141532 aacatcctagatgctcaaattggggtaattgcatttaatttcaaaaatcattagattgcatatttggatagaatgggaagatct 21141449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University