View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17611_low_3 (Length: 233)

Name: NF17611_low_3
Description: NF17611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17611_low_3
NF17611_low_3
[»] chr2 (1 HSPs)
chr2 (21-220)||(41378519-41378721)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 41378721 - 41378519
Alignment:
Q  21 gtagggtcggtggcagttggggagtgtggggtttttggtgtgtagtaggttgttctggtgtttggcccttctgctggtaccttgcagctgctggggttgc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  41378721 gtagggtcggtggcagttggggagtgtggggtttttggtgtgtgggaggttgttttggtgtttggcccttctgctggtaccttgcagctgctggggttgc 41378622  T
Q  121 tgatgttgttatgcagttgtggctgttttgctggtatagtgcagctgctg---ctgtatttttgctgcagtttgctgcacttaagtgggtgttttccttt 217  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||    
T  41378621 tgctgttgttatgcagttgtggctgttttgctggtatagtgcagctgctgcttctgtatttttgctgcagtttgctgcacttaagtgggtgttttccttt 41378522  T
Q  218 gct 220  Q
    |||    
T  41378521 gct 41378519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University