View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17611_low_1 (Length: 254)

Name: NF17611_low_1
Description: NF17611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17611_low_1
NF17611_low_1
[»] chr1 (2 HSPs)
chr1 (88-225)||(49299336-49299464)
chr1 (1-47)||(49299463-49299509)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 88 - 225
Target Start/End: Complemental strand, 49299464 - 49299336
Alignment:
Q  88 atgcaccaaccgaattagcgtctccttggttttttctattagtaaaagacacatttcatttttatttttgtgcttattggtatgcagagtgttgttttag 187  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||    
T  49299464 atgcaccaaccgaattaacgtctccttggttttttctattagtaaaagacacatttcat------ttttgtgcttattggtatgcagagtgttgttttag 49299371  T
Q  188 gcgacttcttcttcgattgggtctatgaatctcgtttc 225  Q
    | ||   |||||||||||||||||||||||||||||||    
T  49299370 gtga---cttcttcgattgggtctatgaatctcgtttc 49299336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 49299509 - 49299463
Alignment:
Q  1 tggttgattagaaagctgctgagagacatatacattatcatggttat 47  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||    
T  49299509 tggttgattagaaagctgcggagagacatatacattatcatggttat 49299463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University