View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17607_low_33 (Length: 214)

Name: NF17607_low_33
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17607_low_33
NF17607_low_33
[»] chr1 (2 HSPs)
chr1 (11-92)||(12474205-12474286)
chr1 (158-201)||(12474353-12474396)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 12474205 - 12474286
Alignment:
Q  11 agtagcataggttgtgacaccgaagaagttatatgtaggaagttcatatttaaactgctttctacgagcatttcttgccttt 92  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||    
T  12474205 agtagcttaggttgtgacaccgaagaagttatatgtaggaagttcatatttaaattgctttctacgaacatttcttgccttt 12474286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 12474353 - 12474396
Alignment:
Q  158 tggttattgaaactttttccatcttcaagacatgtaattagtga 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  12474353 tggttattgaaactttttccatcttcaagacatgtaattagtga 12474396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University