View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17604_high_24 (Length: 212)

Name: NF17604_high_24
Description: NF17604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17604_high_24
NF17604_high_24
[»] chr8 (1 HSPs)
chr8 (51-196)||(42056220-42056365)


Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 51 - 196
Target Start/End: Complemental strand, 42056365 - 42056220
Alignment:
Q  51 gtattcaagtttataggttgttgcacagtttgggatagataagttacaattgttgtaatcatatttgagatagatagttaatacattttattggtgggat 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42056365 gtattcaagtttataggttgttgcacagtttgggatagataagttacaattgttgtaatcatatttgagatagatagttaatacattttattggtgggat 42056266  T
Q  151 ttttctttggaagtaggtacttgtgtgttctaccactttctctgtg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  42056265 ttttctttggaagtaggtacttgtgtgttctaccactttctctgtg 42056220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University