View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1759_high_9 (Length: 235)

Name: NF1759_high_9
Description: NF1759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1759_high_9
NF1759_high_9
[»] chr6 (1 HSPs)
chr6 (15-217)||(34895546-34895748)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 34895546 - 34895748
Alignment:
Q  15 ataaaatggaaaataaaaacctattttggcgatgcaacatactgtaaaattgatgacacgacagggcagtctaagttgcaatctgaaactgcagctggtc 114  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34895546 ataaaatggaaaataaaaacctattttgacgatgcaacatactgtaaaattgatgacacgacagggcagtctaagttgcaatctgaaactgcagctggtc 34895645  T
Q  115 gagtatctcgatatattattctgtcacaccaagcaggaattcgctttttctccccagaatcataccctgcaagattgtacggaagttatgctactgtcat 214  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  34895646 gagtatcacgatatattattctgtcacaccaagcaggaattcgctttttctccccagaatcataccctgcaagattgtacggaagttacgctactgtcat 34895745  T
Q  215 gtt 217  Q
    |||    
T  34895746 gtt 34895748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University