View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17597_low_54 (Length: 216)

Name: NF17597_low_54
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17597_low_54
NF17597_low_54
[»] chr4 (1 HSPs)
chr4 (13-200)||(27641139-27641326)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 27641139 - 27641326
Alignment:
Q  13 tattcttcatcaatcatgtagtatagtatggtagaattgcatgttgtctatcaattagaatttcctttatttattagattacgaacaaccaattttggtt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  27641139 tattcttcatcaatcatgtagtatagtatggtagaattgcatgttgtctatcaattagaatttcctttatttattagattatgaacaaccaattttggtt 27641238  T
Q  113 ttggatgctatagttttgctaaaagctgcaattaatttggaccatgatggtattatacatggtgtttgatgatgattgctgtttagga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27641239 ttggatgctatagttttgctaaaagctgcaattaatttggaccatgatggtattatacatggtgtttgatgatgattgctgtttagga 27641326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University