View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17591_low_7 (Length: 328)

Name: NF17591_low_7
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17591_low_7
NF17591_low_7
[»] chr1 (2 HSPs)
chr1 (178-293)||(28765233-28765345)
chr1 (27-84)||(28765439-28765496)
[»] chr2 (1 HSPs)
chr2 (220-277)||(28854732-28854788)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 178 - 293
Target Start/End: Complemental strand, 28765345 - 28765233
Alignment:
Q  178 tatcgtttgaggacgagcaatgtttaagtcttagatcacccttagtttaatgaagcctttgagtgaaatgcatgacctacttcttatatgtgtctattta 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||    
T  28765345 tatcgtttgaggacgagcaatgtttaagtcttagatcacccttagtttaatgaagcctttgagtgaaatgcatgaccta---cttatatgtgtctattta 28765249  T
Q  278 gttgttgtgataatag 293  Q
    ||||||||||||||||    
T  28765248 gttgttgtgataatag 28765233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28765496 - 28765439
Alignment:
Q  27 caagacgcatattaatatatgctacgtattggaatagattgtgtggtgtcccggacag 84  Q
    ||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||    
T  28765496 caagacgcatattaatatatgctacgtatcggaatagattttgtggtgtcccagacag 28765439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 277
Target Start/End: Original strand, 28854732 - 28854788
Alignment:
Q  220 tagtttaatgaagcctttgagtgaaatgcatgacctacttcttatatgtgtctattta 277  Q
    ||||||||||||||||||||||| |||||||| ||| |||||| | ||||| ||||||    
T  28854732 tagtttaatgaagcctttgagtg-aatgcatggcctccttcttgtttgtgtttattta 28854788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University