View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17591_low_11 (Length: 279)

Name: NF17591_low_11
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17591_low_11
NF17591_low_11
[»] chr5 (2 HSPs)
chr5 (1-154)||(7837257-7837410)
chr5 (224-279)||(7837132-7837187)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 7837410 - 7837257
Alignment:
Q  1 tttcgatggaaattacggtgacaagcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctacca 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7837410 tttcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctacca 7837311  T
Q  101 cgtggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7837310 cgtggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt 7837257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 7837187 - 7837132
Alignment:
Q  224 cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggt 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7837187 cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggt 7837132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University