View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1758_low_50 (Length: 242)

Name: NF1758_low_50
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1758_low_50
NF1758_low_50
[»] chr3 (1 HSPs)
chr3 (1-113)||(44530328-44530439)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 44530328 - 44530439
Alignment:
Q  1 ttttgttaggcagtttgcattagaaacaatactttataggctgcttttttatatgtgaagtgattatgtcaattttacctaagatgaagctagagctttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||    
T  44530328 ttttgttaggcagtttgcattagaaacaatactttataggctgcttttttatatgtgaagtgattatgtcaattttacc-aagatggagctagagctttc 44530426  T
Q  101 atacttgagcttg 113  Q
    |||||||||||||    
T  44530427 atacttgagcttg 44530439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University