View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1758_low_47 (Length: 256)

Name: NF1758_low_47
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1758_low_47
NF1758_low_47
[»] chr6 (2 HSPs)
chr6 (20-162)||(27732836-27732978)
chr6 (161-202)||(27732759-27732800)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 27732978 - 27732836
Alignment:
Q  20 tttgaatctgatggattggctgctaagcttgctagtgctgacagctctttacttattggatcatatctggatgtacctattggacaagaaattaaaaatg 119  Q
    ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27732978 tttgaatctgatggattggctgctaagctggcaagtgccgacagctctttacttattggatcatatctggatgtacctattggacaagaaattaaaaatg 27732879  T
Q  120 caggtaagcttttgtacatgatattattaaattattaaaatac 162  Q
    ||||||||||||||| | |||||||||||||||||||||||||    
T  27732878 caggtaagcttttgtccgtgatattattaaattattaaaatac 27732836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 27732800 - 27732759
Alignment:
Q  161 acctttcgaggctcaaattactgtctgatttgttggtttgtc 202  Q
    |||||| | |||||||||||||||||||||||||| ||||||    
T  27732800 acctttgggggctcaaattactgtctgatttgttgctttgtc 27732759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University