View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1758_high_41 (Length: 262)

Name: NF1758_high_41
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1758_high_41
NF1758_high_41
[»] chr7 (1 HSPs)
chr7 (1-243)||(1430680-1430925)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 1430925 - 1430680
Alignment:
Q  1 aggttgcttgaatacgcgaaactcggttttaaacta---tttttattcttctannnnnnnacagggttttccagagattttgcggggagtgtctatgaat 97  Q
    |||||||||||||||||||||||||||||||||||    ||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
T  1430925 aggttgcttgaatacgcgaaactcggttttaaactcacttttttattcttctacttttttacagggttttccagagattttgcggggagtgtctatgaat 1430826  T
Q  98 ccatatgtaaataaatatatcccgccatttgaggaattcgagattgaccgttgtattctcccaaaaggggaaacagtagtgttcccggcagttccaggtc 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  1430825 ccatatgtaaataaatatatcccgccatttgaggaattcgagattgaccgttgtattctcccaaaagggcaaacagtagtgttcccggcagttccaggtc 1430726  T
Q  198 cgtccatctttttggtcacggccggggaaggatcgatgaacacagg 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  1430725 cgtccatctttttggtcacggccggggaaggatcgatgaacacagg 1430680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University