View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17589_low_32 (Length: 220)

Name: NF17589_low_32
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17589_low_32
NF17589_low_32
[»] chr1 (3 HSPs)
chr1 (29-186)||(50716642-50716803)
chr1 (141-204)||(50715121-50715182)
chr1 (1-51)||(50715071-50715121)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 29 - 186
Target Start/End: Original strand, 50716642 - 50716803
Alignment:
Q  29 aattgtacatttaggatttaattatgcagcttattgcttctttgttttatcgact--------gaagaattacactcgttcactcaatatgtgtttataa 120  Q
    ||||| |||||| |||||||| ||||||||||||||||||||||||||| |||||        |||| |||||||| |||||  ||||||||||||||      
T  50716642 aattgcacattttggatttaactatgcagcttattgcttctttgttttaccgactacataaaagaaggattacactagttcatacaatatgtgtttat-- 50716739  T
Q  121 tttactcccaaaccctaaaatttggatggataactatcaacatatggaagtgtggaatttaccccc 186  Q
    ||  | ||||| |||||||||| ||||||||||||||||||  |||||||||||||||||||||||    
T  50716740 ttaccccccaacccctaaaattgggatggataactatcaac--atggaagtgtggaatttaccccc 50716803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 141 - 204
Target Start/End: Original strand, 50715121 - 50715182
Alignment:
Q  141 tttggatggataactatcaacatatggaagtgtggaatttaccccctcctgtagtgcatgattt 204  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||| |||||||||||||    
T  50715121 tttggatggataactatcaacat--ggaagtgtggaatttaccccctcctatagtgcatgattt 50715182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 50715071 - 50715121
Alignment:
Q  1 acaaaaattaggtcatttatgaaaaaagaattgtacatttaggatttaatt 51  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  50715071 acaaaaattagttcatttatgaaaaaagaattgtacatttaggatttaatt 50715121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University