View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17589_low_30 (Length: 228)

Name: NF17589_low_30
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17589_low_30
NF17589_low_30
[»] chr3 (1 HSPs)
chr3 (15-197)||(22319190-22319372)


Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 22319190 - 22319372
Alignment:
Q  15 gatgaatgtatggaagttagagaaatgattgtcatcttactttgttgagtttaaatatctctcatgcttaataaccaagtgatttttattgttcttattc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  22319190 gatgaatgtatggaagttagagaaatgattgtcatcttactttgttgagtttaaatatctctcatgcttaatatccaagtgatttttattgttcttattc 22319289  T
Q  115 tttatcctctttaactttacagtctaatcccccttattagggttatctcatatttaccttggcttcgttacaacctcaataaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  22319290 tttatcctctttaactttacagtctaatcccccttattagggttatctcatatttaccttggcctcgttacaacctcaataaa 22319372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University