View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17588_low_58 (Length: 215)

Name: NF17588_low_58
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17588_low_58
NF17588_low_58
[»] chr2 (1 HSPs)
chr2 (16-196)||(7668392-7668572)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 7668392 - 7668572
Alignment:
Q  16 caaagggtaggtggtttcggtgcctcgatctgccccaagttttatcgatgaatcaattcttaacttaacccaaacattaactcacatgtgcttcatgttt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  7668392 caaagggtaggtggtttcggtgcctcgatctgccccaagttttatcgatgaatcaattcttaacttaacccaaacattaactcacatgtgcttcatgtta 7668491  T
Q  116 catacaatattgttttggtataatatttggagtcagcagtcacaaaccactaagaaacatgcaactaacgataacataatt 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7668492 catacaatattgttttggtataatatttggagtcagcagtcacaaaccactaagaaacatgcaactaacgataacataatt 7668572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University