View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17588_low_56 (Length: 226)

Name: NF17588_low_56
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17588_low_56
NF17588_low_56
[»] chr5 (1 HSPs)
chr5 (20-187)||(335932-336099)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 336099 - 335932
Alignment:
Q  20 aaggggaatcgaactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaataaaaaatgcaagttggaattggaaataaatggttatag 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||    
T  336099 aaggggaatcgaactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaatcaaaattgcaagttggaattggaaataaatggttatag 336000  T
Q  120 gcatagaaggtaaagagagagaaatccacaaaacaaaacacaagaaggcattgacatcacatgctata 187  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  335999 gcatagaaggtaaagagagagaaatccacaaaacaacacacaagaaggcattgacatcacatgctata 335932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University