View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17584_low_9 (Length: 263)

Name: NF17584_low_9
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17584_low_9
NF17584_low_9
[»] chr8 (1 HSPs)
chr8 (8-242)||(8621968-8622203)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 242
Target Start/End: Original strand, 8621968 - 8622203
Alignment:
Q  8 taatattcttctt-taaatatgatggagagtgtcctaattaaaagttgaaagggatgtcatagtgcaaatcatccaccataacattagatgagtaaagta 106  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8621968 taatattcttcttataaatatgatgcagagtgtcctaattaaaagttgaaagggatgtcatagtgcaaatcatccaccataacattagatgagtaaagta 8622067  T
Q  107 caatagacctttgttttttaagttatctcgttctagattaaaatttgattgcgtgcatagaaatgtcaaagtaataccataaaaagaaatcgaacaaaat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8622068 caatagacctttgttttttaagttatctcgttctagattaaaatttgattgcgtgcatagaaatgtcaaagtaataccataaaaagaaatcgaacaaaat 8622167  T
Q  207 aatgcatttgatatagatttggtctctaacctttag 242  Q
    ||||||||||||||||||||||||||||||||||||    
T  8622168 aatgcatttgatatagatttggtctctaacctttag 8622203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University