View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17584_low_14 (Length: 225)

Name: NF17584_low_14
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17584_low_14
NF17584_low_14
[»] chr5 (1 HSPs)
chr5 (28-201)||(15152543-15152717)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 28 - 201
Target Start/End: Complemental strand, 15152717 - 15152543
Alignment:
Q  28 atattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagnnnnnnnnt-tcaatgagtgctataagcatgaaggagaatatt 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||| ||||||||||||||||||||    
T  15152717 atattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagaaaaaaaaaatcaatgagtgctgtaagcatgaaggagaatatt 15152618  T
Q  127 ttgtaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat 201  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15152617 ttgaaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat 15152543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University