View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17580_low_23 (Length: 227)

Name: NF17580_low_23
Description: NF17580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17580_low_23
NF17580_low_23
[»] chr8 (2 HSPs)
chr8 (1-217)||(27324769-27324986)
chr8 (104-140)||(12587768-12587804)
[»] chr2 (1 HSPs)
chr2 (144-217)||(41596586-41596659)
[»] chr6 (2 HSPs)
chr6 (144-217)||(28916174-28916247)
chr6 (104-140)||(6900350-6900386)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 27324769 - 27324986
Alignment:
Q  1 tgggttgctgggtgggtgtgtttgatatgttactaaatcaataatgggtgggtgttattagcagtatatgtatatatatattnnnnnnnnnnnnnnnnnt 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||    |||||||||                 |    
T  27324769 tgggttgctgggtgggtgtgtttgatatgttactaaagcaatagtgggtgggtgttattagcagtatat----atatatattaaaaaagtttagaaaaat 27324864  T
Q  101 ttatgcatgcaggagcccccacaatcatatgagtggctcc-----tgttatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccat 195  Q
    || |||||| |||||||||||||||||| |||||||||||     || ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27324865 ttgtgcatgtaggagcccccacaatcatgtgagtggctccgcccctgctatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccat 27324964  T
Q  196 ggtaacctaatctttctctctg 217  Q
    | ||||||||||||||||||||    
T  27324965 gttaacctaatctttctctctg 27324986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 140
Target Start/End: Original strand, 12587768 - 12587804
Alignment:
Q  104 tgcatgcaggagcccccacaatcatatgagtggctcc 140  Q
    |||| |||||||||||||||||||| |||||||||||    
T  12587768 tgcaggcaggagcccccacaatcatgtgagtggctcc 12587804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 41596586 - 41596659
Alignment:
Q  144 tatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccatggtaacctaatctttctctctg 217  Q
    ||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||| ||||| |||||||||    
T  41596586 tatggatccgaattttgtcggattcgaaacaacctacaaattcgatgaccatggtaacttaatccttctctctg 41596659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 28916174 - 28916247
Alignment:
Q  144 tatggatccaaattttgttggattcgaaacaacctgcaaattcgatgaccatggtaacctaatctttctctctg 217  Q
    ||||||||| ||||||||||  |||||||| |||| ||||||||||||||| |||||||||||| |||||||||    
T  28916174 tatggatccgaattttgttgatttcgaaaccacctacaaattcgatgaccaaggtaacctaatccttctctctg 28916247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 140
Target Start/End: Complemental strand, 6900386 - 6900350
Alignment:
Q  104 tgcatgcaggagcccccacaatcatatgagtggctcc 140  Q
    |||| |||||||||||||||||||| |||||||||||    
T  6900386 tgcaggcaggagcccccacaatcatgtgagtggctcc 6900350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University