View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17578_low_26 (Length: 224)

Name: NF17578_low_26
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17578_low_26
NF17578_low_26
[»] chr5 (1 HSPs)
chr5 (9-207)||(12870494-12870691)
[»] chr6 (1 HSPs)
chr6 (9-207)||(27765657-27765855)
[»] chr4 (1 HSPs)
chr4 (134-207)||(41810794-41810866)
[»] chr1 (1 HSPs)
chr1 (134-207)||(31770448-31770520)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 12870494 - 12870691
Alignment:
Q  9 gagagagatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttctaacattctcaagaaaa 108  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
T  12870494 gagagcgatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttgtaactttctcaagaaaa 12870593  T
Q  109 tcggtgaagtttattttgatgaaattgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  12870594 tcggtgaagtttattttgatgaaattgtgaggattggagtacgattgttgggatggaatttcttgaatcaattttaggta-ccccttctctcactattt 12870691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 27765657 - 27765855
Alignment:
Q  9 gagagagatgaagtacctcatgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaatcggtgaacttctaacattctcaagaaaa 108  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| |||||||    
T  27765657 gagagcgatgaagtacctcacgtgtcgtgtcttgcttgctgttcatttggttatgcaaaccggattgtaaataggtgaacttataactttcttaagaaaa 27765756  T
Q  109 tcggtgaagtttattttgatgaaattgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt 207  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27765757 tcggtgaagtttattttgatgaaattgtgaggattgaagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt 27765855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 41810794 - 41810866
Alignment:
Q  134 tgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt 207  Q
    ||||||||||||||||||||||||  ||| |||| | ||| |||| |||||||||| | | |||||||||||||    
T  41810794 tgtgaggattggagtacgatggttcagattgaatattttgcatcagttttaggtactcac-tctctcactattt 41810866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 31770520 - 31770448
Alignment:
Q  134 tgtgaggattggagtacgatggttgggatggaatttcttgaatcaattttaggtacccccttctctcactattt 207  Q
    ||||||||||||||||||||||||  ||| |||| | ||| |||| |||||||||| | | |||||||||||||    
T  31770520 tgtgaggattggagtacgatggttcagattgaatattttgcatcagttttaggtactcac-tctctcactattt 31770448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University