View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17578_high_18 (Length: 242)

Name: NF17578_high_18
Description: NF17578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17578_high_18
NF17578_high_18
[»] chr2 (2 HSPs)
chr2 (153-227)||(1709286-1709360)
chr2 (8-86)||(1709427-1709505)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 227
Target Start/End: Complemental strand, 1709360 - 1709286
Alignment:
Q  153 gccttctccttgatctctctccgcaaccttcacttccaactgccgcaacgccctcccaaacgctgaagacaaagc 227  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  1709360 gccttctccttgatctctctccgcaaccttcacttccaactgccccaacgccctcccaaacgctgaagacaaagc 1709286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 1709505 - 1709427
Alignment:
Q  8 ccaccatcttcttccccatccaaaccaactccgccgctactttctccgccggaacacccccttcacctccctttactct 86  Q
    |||||||||||||| |||||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||    
T  1709505 ccaccatcttcttcaccatccaaaccaactccgccgccaatttctccgccggaacaccaccttcacctccctttactct 1709427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University