View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17569_high_54 (Length: 216)

Name: NF17569_high_54
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17569_high_54
NF17569_high_54
[»] chr3 (1 HSPs)
chr3 (1-200)||(51199374-51199573)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 51199374 - 51199573
Alignment:
Q  1 ccctaattcttattgtactttttggcaagtacacttataattttgaggactaaaatgactaattctaaggaataaactatttgcaataaagggtgcttaa 100  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  51199374 ccctaattcttattgtactttttggcaagtgcacttataattttgaggactaaaataactaattctaaggaataaactatttgcaataaagggtgcttaa 51199473  T
Q  101 tttaaatgtgctaaaaatgaaatgaattaggaagctgacccagttgaagagataagcagacaaaatggcaagtgaattgccttctatggctggcaaaaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51199474 tttaaatgtgctaaaaatgaaatgaattaggaagctgacccagttgaagagataagcagacaaaatggcaagtgaattgccttctatggctggcaaaaac 51199573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University