View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17565_high_8 (Length: 413)

Name: NF17565_high_8
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17565_high_8
NF17565_high_8
[»] chr6 (1 HSPs)
chr6 (10-137)||(5997859-5997986)


Alignment Details
Target: chr6 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 10 - 137
Target Start/End: Complemental strand, 5997986 - 5997859
Alignment:
Q  10 ataatactaaggggggccataaacaaggaaagaattttcttcagtgagtccaatgtgcctcttcagttctggaacaccgtaacactaagggcaaccatcg 109  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  5997986 ataacactaaggggggccataaacaaggaaagaattttcttcagtgagtccaatgtgccccttcagttctggaacaccgtaacactaagggcaaccatcg 5997887  T
Q  110 acaagaaaagacagagaataccaaattt 137  Q
    || |||||||||||||||||||||||||    
T  5997886 acgagaaaagacagagaataccaaattt 5997859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University