View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17563_low_23 (Length: 232)

Name: NF17563_low_23
Description: NF17563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17563_low_23
NF17563_low_23
[»] chr8 (2 HSPs)
chr8 (1-217)||(8167465-8167684)
chr8 (70-209)||(8999198-8999337)
[»] chr3 (1 HSPs)
chr3 (36-217)||(50707567-50707748)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 8167465 - 8167684
Alignment:
Q  1 cggtgttagggttagggtaaccacaaacgtagagtttttcgtttggtgaagtgatgatcattgcagtttttgcattgcaaagaatagatagttctgtaac 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||    
T  8167465 cggtgttagggttagggtaaccacaaacgtagagttttccgtttggtgaagtgatgatcattgcagtttttgcattgcataggatagatagttctgtaac 8167564  T
Q  101 tttcttgaagagccctagtttgcgttttgagaaggaatcgcggggcttgtttgattgttctgctttcttgattttaatggt---tctcttacgtttgttg 197  Q
    ||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||    
T  8167565 tttgttgaagagccctagtttgcgttttgagaaggtatcgaggggcttgtttgattgttctgctttcttgattttaatggttgatctcttacgtttgttg 8167664  T
Q  198 ttgctttttgttgatgtgtt 217  Q
    ||||||||||||||||||||    
T  8167665 ttgctttttgttgatgtgtt 8167684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 209
Target Start/End: Original strand, 8999198 - 8999337
Alignment:
Q  70 ttgcattgcaaagaatagatagttctgtaactttcttgaagagccctagtttgcgttttgagaaggaatcgcggggcttgtttgattgttctgctttctt 169  Q
    |||||||||| | |||  |||||| ||| ||||| |||||||| |||| ||||||||||||||||| |||     ||||||| |||| |||| |||||||    
T  8999198 ttgcattgcataaaatgaatagttatgtgactttgttgaagagtcctaatttgcgttttgagaaggtatcatccagcttgttagattcttctactttctt 8999297  T
Q  170 gattttaatggttctcttacgtttgttgttgctttttgtt 209  Q
     |||| | || |||||||| || ||| ||||  |||||||    
T  8999298 aatttcattgattctcttaggtgtgtcgttgtgttttgtt 8999337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 36 - 217
Target Start/End: Original strand, 50707567 - 50707748
Alignment:
Q  36 ttttcgtttggtgaagtgatgatcattgcagtttttgcattgcaaagaatagatagttctgtaactttcttgaagagccctagtttgcgttttgagaagg 135  Q
    |||| |||||||||||||||||||| ||| |||||||||||||| ||||| |||| |||||| ||||| |||||||| ||||||||||| ||||| ||||    
T  50707567 tttttgtttggtgaagtgatgatcagtgcggtttttgcattgcatagaatggataattctgttactttgttgaagagtcctagtttgcgctttgaaaagg 50707666  T
Q  136 aatcgcggggcttgtttgattgttctgctttcttgattttaatggttctcttacgtttgttgttgctttttgttgatgtgtt 217  Q
     ||| ||  ||||||| ||| | | |||||||||||||| ||||||| |||| |||  |||| | | ||||||||| |||||    
T  50707667 tatcacgccgcttgttcgatggctttgctttcttgatttcaatggttttcttccgtgagttgcttcgttttgttgacgtgtt 50707748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University