View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17557_low_4 (Length: 358)

Name: NF17557_low_4
Description: NF17557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17557_low_4
NF17557_low_4
[»] chr4 (1 HSPs)
chr4 (13-165)||(9861126-9861278)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 13 - 165
Target Start/End: Original strand, 9861126 - 9861278
Alignment:
Q  13 aatattgataaagcttgattgtgaacgagttgttcacaatgcagctagcttttcctttgcacacaatagtgaatatgtatcatggnnnnnnnttaatcac 112  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       ||||||||    
T  9861126 aatattgataaagcttgattgtgaacgagttgttcacaatgccgctagcttttcctttgcacacaatagtgaatatgtatcatggaaaaaaattaatcac 9861225  T
Q  113 cagcaagtttacaaattgaattgcctattacaaataatgaatgaacaatgaat 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9861226 cagcaagtttacaaattgaattgcctattacaaataatgaatgaacaatgaat 9861278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University