View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17556_low_39 (Length: 201)

Name: NF17556_low_39
Description: NF17556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17556_low_39
NF17556_low_39
[»] chr4 (1 HSPs)
chr4 (17-150)||(33035850-33035985)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 33035850 - 33035985
Alignment:
Q  17 atcatgaggttccttattttacaaaaaagtgaaattgaaacttgtttctgttatgaaacatgtttctggtttaatctcagtttacttatatgaaattgaa 116  Q
    |||| ||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33035850 atcacgaggttccttattttacaaaaaagtgaaatgaaaacttgtttctgttatgaaacatgtttctggtttaatctcagtttacttatatgaaattgaa 33035949  T
Q  117 acaagagaccaagtga--agatgaacagattcagac 150  Q
    |||| |||||||||||  ||||||||||||||||||    
T  33035950 acaacagaccaagtgatcagatgaacagattcagac 33035985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University