View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17555_low_14 (Length: 211)

Name: NF17555_low_14
Description: NF17555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17555_low_14
NF17555_low_14
[»] chr1 (1 HSPs)
chr1 (14-132)||(6736333-6736451)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 14 - 132
Target Start/End: Complemental strand, 6736451 - 6736333
Alignment:
Q  14 gaagctgagaggttagaggctaggattagttttgcggtgtaacgggagattttgagaagtttgtcaacaccgtcgcgtttggcgaggtaggtttcgaagt 113  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  6736451 gaagctgagaggttagaggcgaggattagttttgcggtgtaacgggagattttgagaagtttgtcaacgccgtcgcgtttggcgaggtaggtttcgaagt 6736352  T
Q  114 gggttaagaaatctcgttc 132  Q
    |||||||||||||||||||    
T  6736351 gggttaagaaatctcgttc 6736333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University