View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17550_high_29 (Length: 213)

Name: NF17550_high_29
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17550_high_29
NF17550_high_29
[»] chr2 (1 HSPs)
chr2 (16-195)||(8922767-8922947)


Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 8922767 - 8922947
Alignment:
Q  16 aaaattaagaaattaacaattataaaaccatattatgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctc 115  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8922767 aaaattaagaaattaacaattataaaaccatattacgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctc 8922866  T
Q  116 caatgctcacttttttaacaaaataacgtttgcatgtttaga-nnnnnnnggtggtgctttgcatgtttagattgagaaca 195  Q
    ||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||    
T  8922867 caatgctcacttttttaacaaaataacgtttgcatgtttagattttttttggtggtgctttgcatgtttagattgagaaca 8922947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University