View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17550_high_14 (Length: 313)

Name: NF17550_high_14
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17550_high_14
NF17550_high_14
[»] chr4 (2 HSPs)
chr4 (132-276)||(4095511-4095652)
chr4 (77-136)||(4095437-4095495)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 132 - 276
Target Start/End: Original strand, 4095511 - 4095652
Alignment:
Q  132 ttttttccaaattgttcatatgtttgttggtaggcagattatatggtcaccgtgtagaagctcgcggtcctccttgtccttgtagctgggatggtgactt 231  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||     
T  4095511 ttttttccaaattgttcatatgtttgctggtaggcagattatatggtcaccgtgtagatgctcgcggtcctccttgtccttgtagctgggatggtgact- 4095609  T
Q  232 gatgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt 276  Q
      |||||||||||||||||||||||||||||||||||||||||||    
T  4095610 --tgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt 4095652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 4095437 - 4095495
Alignment:
Q  77 attgaattgaattgagtattgtaaaaaagttttcttctcttgtaagatatctcaattttt 136  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||    
T  4095437 attgaattga-ttgagtattgtaaaaatgttttcttctcttgtaagatatctcaattttt 4095495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University