View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17548_high_10 (Length: 243)

Name: NF17548_high_10
Description: NF17548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17548_high_10
NF17548_high_10
[»] chr1 (2 HSPs)
chr1 (168-226)||(44533872-44533930)
chr1 (1-53)||(44534045-44534097)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 44533930 - 44533872
Alignment:
Q  168 ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatc 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44533930 ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatc 44533872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 44534097 - 44534045
Alignment:
Q  1 cattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctc 53  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44534097 cattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctc 44534045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University