View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1753_high_8 (Length: 222)

Name: NF1753_high_8
Description: NF1753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1753_high_8
NF1753_high_8
[»] chr8 (1 HSPs)
chr8 (1-222)||(4223335-4223559)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4223559 - 4223335
Alignment:
Q  1 attaaaaagaaggaataaatagtatgataatagaaatgggatagggtttgcggtt--tggtggacatatatgaagctaaaaaagcttagtggtaattgat 98  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||    
T  4223559 attaaaaagaaggaataaatagtattataatagaaatgggatagggttttcggttgatggtggacatatatgaagctaaaaaagcttagtggtaattgat 4223460  T
Q  99 tgtg-ttgtggttgaattctaatttgcttcctaaatatggtcatgctgtaatgtgaactagcacataaaaagtgcagctaaaattttgagtggaataacc 197  Q
    |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4223459 tgtaattgtggttgaattctaatttgcttcctaaatatggtcatgctgtaatgtgaactagtacataaaaagtgcagctaaaattttgagtggaataacc 4223360  T
Q  198 aattgtaatgaaattgacataaaaa 222  Q
    ||||||||||||||| |||||||||    
T  4223359 aattgtaatgaaatttacataaaaa 4223335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University