View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17539_low_41 (Length: 218)

Name: NF17539_low_41
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17539_low_41
NF17539_low_41
[»] chr6 (4 HSPs)
chr6 (1-124)||(34754341-34754464)
chr6 (123-216)||(34754505-34754598)
chr6 (35-128)||(11538121-11538217)
chr6 (35-128)||(11563631-11563727)


Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 34754341 - 34754464
Alignment:
Q  1 tgaatcttacctcttgttcttttctgctgctataacagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaattgaatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34754341 tgaatcttacctcttgttcttttctgctgctataacagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaattgaatgg 34754440  T
Q  101 tgttttcatggatgaacacgacga 124  Q
    ||||||||||||||||||||||||    
T  34754441 tgttttcatggatgaacacgacga 34754464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 123 - 216
Target Start/End: Original strand, 34754505 - 34754598
Alignment:
Q  123 gaggatgcaggagttctagctgacccggactacaatcctgatatggatgaaaatttcagtgatggtggcagcaacagcagcagtagtagtagta 216  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34754505 gaggatccaggagttctagctgacccggactacaatcctgatatggatgaaaatttcagtgatggtggcagcaacagcagcagtagtagtagta 34754598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 128
Target Start/End: Original strand, 11538121 - 11538217
Alignment:
Q  35 acagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaa----ttgaatggtgttttcatggatgaacacgacgaggat 128  Q
    |||||||||||||||| || | ||||| ||||||||| |||| ||||||||||| |||    ||||| || ||||| |||||||||||||||||||||    
T  11538121 acagtcaaggtatagattgttgattgccggtgaagataatgaatcttctgatgaggaattcgttgaa-ggcgtttttatggatgaacacgacgaggat 11538217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 128
Target Start/End: Original strand, 11563631 - 11563727
Alignment:
Q  35 acagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaa----ttgaatggtgttttcatggatgaacacgacgaggat 128  Q
    |||||||||||||||| || | ||||| ||||||||| |||| ||||||||||| |||    ||||| || ||||| |||||||||||||||||||||    
T  11563631 acagtcaaggtatagattgttgattgccggtgaagataatgaatcttctgatgaggaattcgttgaa-ggcgtttttatggatgaacacgacgaggat 11563727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University