View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17536_low_7 (Length: 291)

Name: NF17536_low_7
Description: NF17536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17536_low_7
NF17536_low_7
[»] chr1 (1 HSPs)
chr1 (66-265)||(46009831-46010034)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 66 - 265
Target Start/End: Original strand, 46009831 - 46010034
Alignment:
Q  66 gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46009831 gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga 46009930  T
Q  166 t----gatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagttcacgtgatgagatgctacatgttcatgt 261  Q
    |    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46009931 tgatcgatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagttcacgtgatgagatgctacatgttcatgt 46010030  T
Q  262 tcat 265  Q
    ||||    
T  46010031 tcat 46010034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University