View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17532_high_25 (Length: 210)

Name: NF17532_high_25
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17532_high_25
NF17532_high_25
[»] chr7 (2 HSPs)
chr7 (75-176)||(41261756-41261857)
chr7 (16-54)||(41261717-41261755)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 75 - 176
Target Start/End: Original strand, 41261756 - 41261857
Alignment:
Q  75 gtacgagtaattcaatcaaggaaaattcaaaccactcttggctcctttgatgcacatgatgaatgaaagatacggtgattgtattatactttgtctcaat 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41261756 gtacgagtaattcaatcaaggaaaattcaaaccactcttggctcctttgatgcacatgatgaatgaaagatacggtgattgtattatactttgtctcaat 41261855  T
Q  175 gt 176  Q
    ||    
T  41261856 gt 41261857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 41261717 - 41261755
Alignment:
Q  16 aagaaaacaaaaacaaaagcgtatcaaattttggcttat 54  Q
    |||||||||||||||||||||||||||||||||||||||    
T  41261717 aagaaaacaaaaacaaaagcgtatcaaattttggcttat 41261755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University