View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1752_high_13 (Length: 230)

Name: NF1752_high_13
Description: NF1752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1752_high_13
NF1752_high_13
[»] chr7 (1 HSPs)
chr7 (9-228)||(44461122-44461341)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 44461341 - 44461122
Alignment:
Q  9 gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44461341 gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa 44461242  T
Q  109 tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44461241 tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac 44461142  T
Q  209 caaaaaatgaaccctgcatc 228  Q
    ||||||||||||||| ||||    
T  44461141 caaaaaatgaacccttcatc 44461122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University