View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17523_low_27 (Length: 297)

Name: NF17523_low_27
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17523_low_27
NF17523_low_27
[»] chr4 (1 HSPs)
chr4 (15-134)||(14050108-14050227)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 15 - 134
Target Start/End: Complemental strand, 14050227 - 14050108
Alignment:
Q  15 agaaaaaacacaaatatccacatagctaattcgtgaataaattacctagttgtttttcttccaaatgtcatttatcacaagaaagaatgacggtaataga 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||    
T  14050227 agaaaaaacacaaatatccacatagctaattcgtgaataaattacccagttgtttttcttccaaatgtcatttatcacaagaaagaatgacagtaagaga 14050128  T
Q  115 tcaaataaatgtagcaccac 134  Q
    ||||||||||||||||||||    
T  14050127 tcaaataaatgtagcaccac 14050108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University