View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1751_low_16 (Length: 210)

Name: NF1751_low_16
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1751_low_16
NF1751_low_16
[»] chr3 (1 HSPs)
chr3 (15-195)||(53810930-53811109)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 53811109 - 53810930
Alignment:
Q  15 gagagagagtcttgagatacttgagtgaaacttcaaacagttgagtgcaaggtttgtggtttcaactcaatggattaacagctttgggtattcaaaatat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  53811109 gagagagagtcttgagatacttgagtgaaacttcaaacagttgagtgcaaggtttgtggtttcaactcaatggatta-cagctttgggtattcaaaatat 53811011  T
Q  115 tgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaatgttaatctaattgaacggactatgtg 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53811010 tgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaatgttaatctaattgaacggactatgtg 53810930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University