View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1751_low_12 (Length: 236)

Name: NF1751_low_12
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1751_low_12
NF1751_low_12
[»] chr5 (1 HSPs)
chr5 (12-143)||(8628565-8628696)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 12 - 143
Target Start/End: Complemental strand, 8628696 - 8628565
Alignment:
Q  12 ataagggtgagttgaaaatatggtttgatgactatgtcgtgatatcattttcacgattatactactatggttaaccataaaatttcatacactatgtttt 111  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||||||||||||| ||| |    
T  8628696 ataagggtgagtcgaaaatatggtttgatgactatgtcgtgatatcatttttacaattatattattatggttaaccataaaatttcatacactacgttgt 8628597  T
Q  112 atgttttgtgttgattcgattgtgtaaaagat 143  Q
     |||||| | |||||||||||||||| |||||    
T  8628596 gtgttttatattgattcgattgtgtagaagat 8628565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University