View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17515_high_31 (Length: 252)

Name: NF17515_high_31
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17515_high_31
NF17515_high_31
[»] chr1 (1 HSPs)
chr1 (16-132)||(32006200-32006316)
[»] chr3 (1 HSPs)
chr3 (18-66)||(49731319-49731367)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 32006200 - 32006316
Alignment:
Q  16 tgtgcattggcaaaggccggtccctggtcaactcaagtgtaatatagatgcagctttttgtggtctttaaatcttataggaattggcatatgtgtacgag 115  Q
    |||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||    
T  32006200 tgtgcattggcaaaggtcggcccctgatcagctcaagtgtaatatagatgcagcttttcgtggtctttaaattgtataggaattggcatatgtgtacgag 32006299  T
Q  116 ataatgaaggaactttt 132  Q
    || ||||||||||||||    
T  32006300 atgatgaaggaactttt 32006316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 49731367 - 49731319
Alignment:
Q  18 tgcattggcaaaggccggtccctggtcaactcaagtgtaatatagatgc 66  Q
    |||||||||||||| || |||||||||  ||||||||||||||||||||    
T  49731367 tgcattggcaaaggtcgatccctggtcgtctcaagtgtaatatagatgc 49731319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University