View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1750_low_12 (Length: 328)

Name: NF1750_low_12
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1750_low_12
NF1750_low_12
[»] chr1 (1 HSPs)
chr1 (37-312)||(40897736-40898010)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 37 - 312
Target Start/End: Complemental strand, 40898010 - 40897736
Alignment:
Q  37 ggtgtatgttttggctgtacgaagcaatggatttgatgcgagttataagaaaatgagattggctctattgagtgtaatgttggtggtgatacttgttgct 136  Q
    |||| ||||||||||||||| ||| ||||||||||||| |||||| ||||||||| ||||||||||||||| ||||||||| ||  ||||||||||||||    
T  40898010 ggtgaatgttttggctgtaccaagaaatggatttgatgtgagttacaagaaaatgggattggctctattgaatgtaatgttagtaatgatacttgttgct 40897911  T
Q  137 gtcttaggttttctatttatagatggtagagccataaggagagaaatgcatctgtgtgcctcactcatcaaacaaaaagaggccactcaccaagttgaga 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||    
T  40897910 gtcttaggttttctatttatagatggtagagccataaggagagaaatgcatttgtgtgcctcacttatcaaacaaaaagaggccactcaccaagctgaga 40897811  T
Q  237 ggaaaaaatatgaacaagagcctcgtcgttgctagcgccagccacgacgtttgcacttctcttgcaggcattactg 312  Q
     |||||||||||||||||||||||| |||||||||||| ||||| || ||| |||||||||| |||||||||||||    
T  40897810 -gaaaaaatatgaacaagagcctcgccgttgctagcgctagccatgatgttcgcacttctctcgcaggcattactg 40897736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University