View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17507_low_11 (Length: 254)

Name: NF17507_low_11
Description: NF17507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17507_low_11
NF17507_low_11
[»] chr8 (2 HSPs)
chr8 (59-139)||(5421739-5421819)
chr8 (181-237)||(5421816-5421871)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 59 - 139
Target Start/End: Original strand, 5421739 - 5421819
Alignment:
Q  59 actacaagatttctatattgcagctcaaagcgtagacatggagtattggcatgaaaatcttccttgcaaaaaggagcatgc 139  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5421739 actataagatttctatattgcaactcaaagcgtagacatggagtattggcatgaaaatcttccttgcaaaaaggagcatgc 5421819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 237
Target Start/End: Original strand, 5421816 - 5421871
Alignment:
Q  181 atgcccttattacttcttttactactcaaagcaacattagcattcatggatagttaa 237  Q
    ||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||    
T  5421816 atgcccttattgcttcttt-actactcaaagcaacattggcattcatggatagttaa 5421871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University