View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17505_low_24 (Length: 246)

Name: NF17505_low_24
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17505_low_24
NF17505_low_24
[»] chr2 (2 HSPs)
chr2 (85-218)||(31845737-31845867)
chr2 (19-81)||(31845706-31845768)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 85 - 218
Target Start/End: Original strand, 31845737 - 31845867
Alignment:
Q  85 ccactcgaatcccaacttttgtgggaatctaacaaactagagaattgatctagttagattcatctaacaactgatattttgttagaggtaataaggctaa 184  Q
    |||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||     
T  31845737 ccactcaaatcccaacttttgtgggaatctaacaaactagagtatcgatctagttagattcatctaacaactgatattttgttagagttaataaggctag 31845836  T
Q  185 tccttattattgagttattagtatcatatccaat 218  Q
    ||||||||||||||   |||||||||||||||||    
T  31845837 tccttattattgag---ttagtatcatatccaat 31845867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 31845706 - 31845768
Alignment:
Q  19 tattgagcaggacatgatccctacatccgttccactcaaatcccaactcatgtgggaatctaa 81  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||    
T  31845706 tattgagcaggacatgatccctacatccgtcccactcaaatcccaacttttgtgggaatctaa 31845768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University