View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17505_high_25 (Length: 227)

Name: NF17505_high_25
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17505_high_25
NF17505_high_25
[»] chr5 (1 HSPs)
chr5 (64-227)||(10358323-10358486)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 10358486 - 10358323
Alignment:
Q  64 gatactgaatgaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata 163  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10358486 gatactgaataaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata 10358387  T
Q  164 ttttttgaatgttgtgatttgatattgttgctgcgtcctgtttcgtgtgatttttgaaattaaa 227  Q
    |||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
T  10358386 ttttttgaatcttgtgatttgatattgttgttgcgtcctgtttcgtatgatttttgaaattaaa 10358323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University