View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17504_low_9 (Length: 238)

Name: NF17504_low_9
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17504_low_9
NF17504_low_9
[»] chr5 (1 HSPs)
chr5 (32-228)||(22294550-22294746)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 32 - 228
Target Start/End: Complemental strand, 22294746 - 22294550
Alignment:
Q  32 tcatattgatcagtgatactactgaggttggactaacactttgatggattgggagtgtcagtcagtgatgaaatggagtggaccactgtgtgatataatt 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22294746 tcatattgatcagtgatactactgaggttggactaacactttgatggattgggagtgtcagtcagtgatgaaatggagtggaccactgtgtgatataatt 22294647  T
Q  132 atattatgttatgtgttgctgtttttggggtttcacccaaagttctgtcttttcccttttcagaccaactacaaacagatcattttcaccacctttg 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  22294646 atattatgttatgtgttgctgtttttggggtttcacccaaagttctgtcttttcccttttcagaccaactacaaacagattattttcaccacctttg 22294550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University