View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1749_low_10 (Length: 218)

Name: NF1749_low_10
Description: NF1749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1749_low_10
NF1749_low_10
[»] chr4 (1 HSPs)
chr4 (55-207)||(49704897-49705049)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 55 - 207
Target Start/End: Complemental strand, 49705049 - 49704897
Alignment:
Q  55 ttgtgtattgagtttgatcttcctattgcacttccaaaaagtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct 154  Q
    |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49705049 ttgtgtattgagcttgatcttcctattgcacttccaaaacgtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct 49704950  T
Q  155 tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagt 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49704949 tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagt 49704897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University