View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17499_high_16 (Length: 226)

Name: NF17499_high_16
Description: NF17499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17499_high_16
NF17499_high_16
[»] chr6 (2 HSPs)
chr6 (137-212)||(6458979-6459054)
chr6 (16-54)||(6458859-6458896)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 212
Target Start/End: Original strand, 6458979 - 6459054
Alignment:
Q  137 tctttatgagttatgcatttcacaacaaaaacatgaaattgtttagcatattataaggtaacttgtttgaagaaag 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6458979 tctttatgagttatgcatttcacaacaaaaacatgaaattgtttagcatattataaggtaacttgtttgaagaaag 6459054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 6458859 - 6458896
Alignment:
Q  16 tgaatagaaatagaaaggttggttactgtgttttatatt 54  Q
    |||||||||||||||||||||||||||| ||||||||||    
T  6458859 tgaatagaaatagaaaggttggttactg-gttttatatt 6458896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University