View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17496_low_34 (Length: 256)

Name: NF17496_low_34
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17496_low_34
NF17496_low_34
[»] chr6 (1 HSPs)
chr6 (61-237)||(23258522-23258699)


Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 61 - 237
Target Start/End: Original strand, 23258522 - 23258699
Alignment:
Q  61 cacttggctcaaaatgaacaaggttattaaaatatcctctttctattttattttatttta--aggcatgttatcaaaatatctattgctgcgtcactata 158  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||  ||||||||||||||    
T  23258522 cacttggctcaaaatgaacaaggttatcaaaatatcctctttctattttattttattttataaggcatgttatgaaaatatctac-gctgcgtcactata 23258620  T
Q  159 caaggttattatatgattcagaggaatttactctttttggctctccatccctttcaaacccacatgttattgattgcgc 237  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||    
T  23258621 caaggttattatatgattcagaggaatttactatttttggctctccatccctttcaaacccacatgttactgattgcgc 23258699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University