View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17494_low_11 (Length: 302)

Name: NF17494_low_11
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17494_low_11
NF17494_low_11
[»] chr5 (1 HSPs)
chr5 (1-268)||(42752127-42752394)


Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 42752127 - 42752394
Alignment:
Q  1 aatggaagcctcaactatggaacaagttctgcaaattccaatgcatacattggatcaggaagtgggaatgttggaggaaatgcatttggcaatactggag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  42752127 aatggaagcctcaactatggaacaagttctgcaaattccaatgcatacattggatcaggaagtgggaatgttggaggaaatgcatttggcaatactggtg 42752226  T
Q  101 tcaactggagttcttcgccgatttctggacatggtggcgggaacaatgtgtcacagggtagtggcaatcttggatatggaggtggcaacaacggttatgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42752227 tcaactggagttcttcgccgatttctggacatggtggcgggaacaatgtgtcacagggtagtggcaatcttggatatggaggtggcaacaacggttatgg 42752326  T
Q  201 attggggactgaagggtatggaagaagcagtggttccactctcgcaccaacattttcaacctctacat 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  ||||||||    
T  42752327 attggggactgaagggtatggaagaagcagtggttccactctcgcaccaacatcttcatactctacat 42752394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University