View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1748_high_26 (Length: 209)

Name: NF1748_high_26
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1748_high_26
NF1748_high_26
[»] chr5 (1 HSPs)
chr5 (19-193)||(7720838-7721012)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 7721012 - 7720838
Alignment:
Q  19 atgataatgatcagggtgccaaaataattgtgatggcttgcatggatgtgttttcccaaaactgcaatgacttactgtaattcttccaaattcaccatta 118  Q
    |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7721012 atgatagtgatgagggtgccaaaataattgtgatggcttgcatggatgtgttttcccaaaactgcaatgacttactgtaattcttccaaattcaccatta 7720913  T
Q  119 gtcacataacatgcatgaaaaaatatttgtgtttgcaacacacatgattaacgagagtgtgggatatgccaaatt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7720912 gtcacataacatgcatgaaaaaatatttgtgtttgcaacacacatgattaacgagagtgtgggatatgccaaatt 7720838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University